Catalogo Articoli (Spogli Riviste)

OPAC HELP

Titolo:
FUNCTIONAL MAP OF A PLACENTA-SPECIFIC ENHANCER OF THE HUMAN LEUKEMIA INHIBITORY FACTOR-RECEPTOR GENE
Autore:
WANG ZY; MELMED S;
Indirizzi:
CEDARS SINAI MED CTR,DIV ENDOCRINOL,8700 BEVERLY BLVD,B-131 LOS ANGELES CA 90048 UNIV CALIF LOS ANGELES,SCH MED,CEDAR SINAI RES INST LOS ANGELES CA 90048
Titolo Testata:
The Journal of biological chemistry
fascicolo: 40, volume: 273, anno: 1998,
pagine: 26069 - 26077
SICI:
0021-9258(1998)273:40<26069:FMOAPE>2.0.ZU;2-W
Fonte:
ISI
Lingua:
ENG
Soggetto:
ALPHA-SUBUNIT GENE; TISSUE-SPECIFIC ENHANCER; ELEMENT-BINDING PROTEIN; IL-6 SIGNAL TRANSDUCER; FACTOR LIF RECEPTOR; CHORIONIC SOMATOMAMMOTROPIN; ADENOSINE-DEAMINASE; TARGETED DISRUPTION; CYTOKINE RECEPTORS; HUMAN ENDOMETRIUM;
Tipo documento:
Article
Natura:
Periodico
Settore Disciplinare:
Science Citation Index Expanded
Citazioni:
55
Recensione:
Indirizzi per estratti:
Citazione:
Z.Y. Wang e S. Melmed, "FUNCTIONAL MAP OF A PLACENTA-SPECIFIC ENHANCER OF THE HUMAN LEUKEMIA INHIBITORY FACTOR-RECEPTOR GENE", The Journal of biological chemistry, 273(40), 1998, pp. 26069-26077

Abstract

We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (-4625/-4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (-4617/-4602) with nuclear extract was competed by a known Oct-1oligo and supershifted by Oct-1 antibody. Specific binding of region B (-4549/-4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (-4464/-4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE,CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary ofPSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of similar to 160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in human LIFR gene.

ASDD Area Sistemi Dipartimentali e Documentali, Università di Bologna, Catalogo delle riviste ed altri periodici
Documento generato il 04/12/20 alle ore 18:43:27